circad | circRNAs associated with diseases

circRUNX2
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Osteoporosis	ICD-10	Osteopathies and chondropathies (M80-M94)
DBLink	Link to database	PMID	30324718
Experimental Method
Sample Type	Bone and cell lines	Comparison	Trabecular bone samples from the trochanteric region of the femur at a site far from the periarticular bone were obtained from 20 patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ATCCACTCTACCACCCCGCT Reverse GTCATAGGACCACGGCGG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Yin, Q, Wang, J, Fu, Q, Gu, S, Rui, Y (2018). CircRUNX2 through has-miR-203 regulates RUNX2 to prevent osteoporosis. J. Cell. Mol. Med., 22, 12:6112-6121.